WebbTable S1. Oligonucleotides used in this study. Related to STAR Methods section. Name Sequence (5'-3') Purpose BoNTA_10R GGCCGGCATGCGGCCGGTACCCTCACTGCAGCGGACGTTCGCC WebbTherefore, pHIS1522 can be used as a versatile expression vector in both, B. megaterium and E. coli. Keywords: Bacillus megaterium / Escherichia coli / Expression vector / Xylose operon Received: December 25, 2010; revised: March 31, 2011; accepted: April 8, 2011 DOI: 10.1002/elsc.201000225 1 Introduction commonly used to control the production of …
Expression of recombinant Clostridium difficile toxin A and B in ...
WebbProduct Summary. The General Flow Sensor determines the fluid velocity of air or water by measuring the difference in pressure between the two input tubes. The Venturi Tube or … Webb10 apr. 2024 · The resulting Cediranib construct pHis1522-TcdB1556 encodes the C-terminal truncated TcdB1852. All constructs were sequenced. Generation of specific antibody Immunization of a female New Zealand rabbit was performed after standard protocol using the affinity purified immunogen TcdA1875710. try not to laugh yt
How to prepare protoplasts of Bacillus megaterium
Webb27 feb. 2024 · IPTG act as a molecular mimic of allolactose and initiate transcription of lac operon and trigger expression of the inserted genes under the control of this Lac operon (in this case HriGFP gene). The HriGFP pet28+ construct was directly transformed in E. coli (BL21DE3 cells), however, for transformation in Bacillus megaterium the gene was sub ... WebbJuly 2, 2015: An aliquot of purified pHis1522-aTcdB vector was acquired from Dr. Xingmin Sun from the Tufts Vet School. NIH-recommended simple letter format MTA forms were signed by both parties. (aTcdB = atoxic Clostridium difficile toxin B) July 6, 2015: The pHis1522-aTcdB was diluted 1:10 and 1ul was transformed into JM109 E. coli. WebbCatalog Datasheet MFG & Type PDF Document Tags; Not Available. Abstract: No abstract text available Text: ITEM 1 2 Q'TY 1 1 PART NUMBER FLP-LC FLPS1522-X.XXX PART … try not to laugh with mr. beast